بلوگل

تمامی اطلاعات, خبرها و مقالات بصورت خودکار از سایت های فارسی دریافت و با ذکر منبع نمایش داده می شوند و بلوگل هیچگونه مسئولیتی در قبال محتوای آنها ندارد .
تولبار و نحوه استفاده از آن

تبلیغات

افزایش ورودی گوگل

خیریه مهربانه

پست ثابت

همت 110

تبلیغات

آی پی نما


پروژه دانشجویی مقاله بررسی بازار فولاد در جهان ایران تحت word

دانلود بازی legndery mahjong  
Mahjong افسانه‌ای مدت‌ها پیش , مردم کرد که قبل از خدایان قدیم آن‌قدر بی‌توجه شد که آنها را فراموش کرده بودند . اینخدایان باستان به خشم و تصمیم گرفت تا آنها را مجازات کند . اما یکی از خدایان برای مردم و می‌خواست برای کمک به آنها از مجازات آنها . او نمی‌تواند خودش را شخصا در امور فانی , با این حال, این را به شما از او حمایت کندو ویران ساخت. برای موفقیت در زمان , ارباب 6 بازی مختلف در افسانه‌ای Mahjong ! دستورالعملهایی : م

دانلود بازی legndery mahjong 
نماز اول وقت « شاه کلید » است !  
√ جوانے نزد شیخ حسنعلے نخودکے آمد و گفت : 
سـ ه قفل در زندگے ام وجود دارد و سـ ه کلید از شما مےخواهم.
قفل اول اینست کــ ه دوست دارم یک ازدواج سالم داشته باشم.
قفل دوم اینکــ ه دوست دارم کارم برکت داشته باشد.
قفل سوم اینکــ ه دوست دارم عاقبت بخیر شوم.
شیخ فرمود :
براے قفل اول نمازت را اول وقت بخوان.
براے قفل دوم نمازت را اول وقت بخوان.
براے قفل سوم نمازت را اول وقت بخوان. 

جوان عرض کرد: سـ ه قفل با یک کلید ؟! 
شیخ فرمود : نماز اول وقت « شاه کلید » است !

نماز اول وقت « شاه کلید » است ! 
ده تحفه برای لقای دوست  
1. دائما طاهر باش و به حال خویش ناظر باش.
2. عیوب دیگران را ساتر باش. 
3. با همه مهربان باش و از همه گریزان باش . یعنى با همه باش و بى همه باش.
4. خداشناس باش در هر لباس باش. 
5. از امل چشم پوش و در عمل کوش.
6. مرد جستجوى باش نه گفتگوى.
7. از دریا بخواه نه از جوى.
8. از فضول کلام چون فضول طعام دست بدار . 
9. به فکر خود باش . 
10. خروس در سحر به ذکر قدوس سبوح در خروش است. کم از خروس مباش. چون به خروش آمدى بدان که بهترین عطاى دوست لقاى اوست. 
مترصد باش که :
 گدایى گردد

ده تحفه برای لقای دوست 
مهربانی  
ﺩﯾﺮ ﮐﺮﺩﻩ ﺑﻮﺩ. ﻫﯿﭽﻮﻗﺖ ﺑﺮﺍﯼ ﻧﻤﺎﺯ ﺟﻤﺎﻋﺖ ﺩﯾﺮ ﻧﻤﯽ ﺁﻣﺪ. ﻧﮕﺮﺍﻧﺶ ﺷﺪﻧﺪ ﻭ ﺭﻓﺘﻨﺪ ﺩﻧﺒﺎﻟﺶ. ﺩﯾﺪﻧﺪ ﺑﭽﻪ ﺍﯼ ﺭﺍ ﺳﻮﺍﺭ ﮐﻮﻟﺶ ﮐﺮﺩﻩ ﻭ ﺑﺮﺍﯾﺶ ﻧﻘﺶ ﺷﺘﺮ ﺭﺍ ﺑﺎﺯﯼ می کند. ﮔﻔﺘﻨﺪ : “ﺍﺯ ﺷﻤﺎ ﺑﻌﯿﺪ ﺍﺳﺖ ؟؟ ﻧﻤﺎﺯ ﺩﯾﺮ ﺷﺪ.”ﺭﻭ ﺑﻪ ﺑﭽﻪ ﮐﺮﺩ ﻭ ﮔﻔﺖ : “ﺷﺘﺮﺕ ﺭﺍ ﺑﺎ ﭼﻨﺪ ﮔﺮﺩﻭ ﻋﻮﺽ ﻣﯿﮑﻨﯽ ؟”ﺑﭽﻪ ﭼﯿﺰﯼ ﮔﻔﺖ …ﮔﻔﺖ : “ﺑﺮﻭﯾﺪ ﮔﺮﺩﻭ ﺑﯿﺎﻭﺭﯾﺪ ﻭ ﻣﺮﺍ ﺑﺨﺮﯾﺪ.”ﮐﻮﺩﮎ می خندید ، ﭘﯿﺎﻣﺒﺮ ﻫﻢ...
 

مهربانی 
انجمن اسلامی از دیدگاه بزرگان  
امام خمینی(ره)
 
شما مجموعه ای هستید که سعی می کنید، نگذارید کسی غرق بشود؛ نگذارید کسی اشتباه بکند؛ نگذارید کسی متوقف بماند.
مقام معظم رهبری
بیانات مقام معظم رهبری در جمع اعضای انجمن های اسلامی و مربیان
و مسئولان تربیتی:
هر انجمن‌ اسلامی‌ دانش‌آموزی‌ در کشور، یک‌ سنگر فرهنگی‌ است‌ که‌ سلاح‌ این‌ سنگر، دین‌، تدبیر، علم‌، فکر و فرهنگ‌ می‌باشد.اگر این‌ سنگرها مستحکم‌ باشند، دشمن‌ در تو

انجمن اسلامی از دیدگاه بزرگان 
سیدی با صلابتت استکبار جهانی را نابود خواهی کرد  
فقط سید علی می تواندباصلابت و قدرت تمام در برابر استکبار جهانی بایستد و بامستکبران مبارزه کند.فقط سید_علی می تواندایران را به قدرتی تبدیل کند که ملت آن بی ارزش ترین کشور راآمریکامنفور ترین دولت را اسرائیل غاصب کودک کش بشناسد.فقط سید_علی می تواند زمانی که تمام مسئولان در برابر تهدیدهای آمریکا سکوت کردندبا سخنرانی کوبنده جوابگوی تهدید ها باشدفقط سید_علی می توانددر برابر تهدیدهای دو مقام آمریک

سیدی با صلابتت استکبار جهانی را نابود خواهی کرد 
رابطه  
تا حرف عشق میشه من میــــرم
من سخت از این حرفا دورم
منم یه روز عاشقی کردم ، از وقتی عاشق شدم اینجورم
دارو ندارم پای عشقم رفت
چیزی نموند جز ، درد نامحدود
این جای خالی که تو سینم هست
قبلاً یه روزی جای قلبـــــــــــم بود
این روزگار بد کرده با قلبم، کم بوده از این زندگی سهمم
دلیل می بافم برای عــــشق، برای چیزی که نمی فهمم
از آدمای شهر بیزارم ، چون با یکی شون خاطره دارم
به من نگو با عشق بی رحمی
من زخم دارم ، تو نمی فهمی
♫♫♫
غریبه ام با این خیابونا

رابطه 
آواهنگ های پیشواز آلبوم مخاطب خاص- علی عبدالمالکی  
 


3318805
نشد
علی عبدالمالکی

 3318792
هوا دو نفره س
علی عبدالمالکی

 3318793
و
علی عبدالمالکی

 3318794
عشق من
علی عبدالمالکی

 3318795
مخاطب خاص
علی عبدالمالکی

 3318796
عکس لب دریا
علی عبدالمالکی

 3318797
یهویی
علی عبدالمالکی

 3318798
سخته
علی عبدالمالکی

 3318799
تیکه کلام
علی عبدالمالکی

 3318800
بی جهت نیست
علی عبدالمالکی

 3318801
هوا بارونیه
علی عبدالمالکی

 3318802
تو حق نداری
علی عبدالمالکی

 3318803
گریه نکن
علی عبدا

آواهنگ های پیشواز آلبوم مخاطب خاص- علی عبدالمالکی 
زندگی نامه شهید جهاد مغنیه  
شهید جهاد مغنیه در سال 1991 در لبنان در خانواده ایی مبارز متولد شد.
جهاد چهارمین شهید از خانواده مغنیه می باشد وی یک خواهر و یک برادر به نام های فاطمه ومصطفی داشت.
.
وی تحصیلات عالیه را در رشته مدیریت در دانشگاه آمریکایی بیروت یکی از بهترین دانشگاه های خاور میانه
شروع کرد و تنها یک درس باقی مانده بود تا مدرکش را بگیرد که به مقام والای شهادت نائل شد.
.
در طول سال های جنگ داخلی سوریه ، حزب الله توانست به کمک ایران و سوریه زیر ساختهای
جولان را بدست گ

زندگی نامه شهید جهاد مغنیه 
چگونه اعداد در Microsoft Word فارسی می شود؟  
برای اینکه اعداد را در ورد فارسی تایپ شود باید از طریق تنظیمات نرم افزار Word فارسی سازی اعداد در ورد بطور کامل انجام شود.
در اینجا با انجام مراحل ذکر شده چگونگی حل مشکل تایپ اعداد فارسی در MS Word 2003 و MS Word 2007 آموزش داده شده است.
 
ادامه مطلب

چگونه اعداد در Microsoft Word فارسی می شود؟ 
جملاتی با خدا !  
گفتم: چقدر احساس تنهایی می‌کنم …
گفتی: فانی قریب
من که نزدیکم (بقره/۱۸۶)
گفتم: تو همیشه نزدیکی؛ من دورم… کاش می‌شد بهت نزدیک شم …
گفتی: و اذکر ربک فی نفسک تضرعا و خیفة و دون الجهر من القول بالغدو و الأصال
هر صبح و عصر، پروردگارت رو پیش خودت، با خوف و تضرع، و با صدای آهسته یاد کن (اعراف/۲۰۵)عمـــــارهـا313

جملاتی با خدا ! 
چراغ  
«آن که بر در می‌کوبد شباهنگام، به کشتن چراغ آمده است...». توفان فرا رسید... . چه می‌خواهند از آشیان عاشقانه مهر و ماه؟ تو بنشین بانو! تو برنخیز به گشودن در؛ تو پشت در نایست! نرو...، همین جا بمان. آن که مشت بر در خانه‌ات می‌کوبد، با خداوند در ستیز است.
 بسیج دانش اموزی دبیرستان دخترانه تربیت

چراغ 
آهنگ های پیشواز آلبوم از عشق- حمید عسکری  
 


3318738
عشق تو
حمید عسکری

 3318735
خواهش میکنم
حمید عسکری

 3318736
خواهش میکنم قطعه 2
حمید عسکری

 3318737
ایده آل
حمید عسکری

 3318739
عشق تو قطعه 2
حمید عسکری

 3318740
فراموشی
حمید عسکری

 3318741
میترسم
حمید عسکری

 3318742
گریه مرد
حمید عسکری

 3318743
گریه مرد قطعه 2
حمید عسکری

 3318744
عشق سابق
حمید عسکری

 3318745
خط به خط
حمید عسکری

 3318746
ماه من
حمید عسکری

 3318747
از عشق
حمید عسکری

 3318748
کناریت
حمید عسکری

 3318749
ک

آهنگ های پیشواز آلبوم از عشق- حمید عسکری 
با نیکان  
سوره مبارکه آل عمران
آیه شریفهرَبَّنَا فَاغْفِرْ لَنَا ذُنُوبَنَا وَکَفِّرْ عَنَّا سَیِّئَاتِنَا وَتَوَفَّنَا مَعَ الأبْرَار رَبَّنَا وَآتِنَا مَا وَعَدتَّنَا عَلَى رُسُلِکَ وَلاَ تُخْزِنَا یَوْمَ الْقِیَامَةِ إِنَّکَ لاَ تُخْلِفُ الْمِیعَادَمعنای آیه:پروردگارا، گناهان ما را ببخش و زشتی های ما را بپوشان و ما را با نیکان قرار ده.پروردگارا، آنچه توسط پیامبرانت به ما وعده داده ای به ما مرحمت فرما و ما را در قیامت خوار مساز، که البته

با نیکان 
جادوی کیمیا  
ماه در ماه رمضان روزه ای که میگیریم  فقط این نیست که انسان نباید بخورد و بیاشامد. این نخوردن و نیاشامیدن، باید از روى نیت باشد، به خدا اگر شما یک روز به‌خاطر گرفتارى و یا اشتغال به کار، دوازده ساعت، پانزده ساعت فرصت نکنید چیزى بخورید، هیچ ثوابى به شما نخواهند داد. اما همین مسائل وقتى با نیت انجام دادید -«اجعلنا ممّن نوى فعمل»؛ نیت کند و به دنبال آن، عمل انجام دهد- این همان گوهر درخشانى مى‌شود که به شما ارزش مى‌بخشد و روحتان را قیمتى مى‌کند.


جادوی کیمیا 
قرآن ! من شرمنده ام…  
قرآن ! من شرمنده توام ،اگر از تو آواز مرگی ساخته ام که هر وقت در کوچه مان آوازت بلند می شود همه از هم می پرسند:« چه کس مرده است؟!»
جه غفلت بزرگی که می پنداریم خدا ترا برای مردگان ما نازل کرده است….
قرآن ! من شرمنده توام اگر ترا از یک نسخه عملی به یک افسانه موزه نشین مبدل کرده ام.یکی ذوق می کند که ترا بر روی دانه برنج نوشته ، یکی ذوق می کند که ترا فرش کرده ، یکی ذوق میکند که ترا با طلا نوشته ، یکی به خود می بالد که ترا در کوچک ترین قطع مم

قرآن ! من شرمنده ام… 
قرآن ! من شرمنده ام…  
قرآن ! من شرمنده توام ،اگر از تو آواز مرگی ساخته ام که هر وقت در کوچه مان آوازت بلند می شود همه از هم می پرسند:« چه کس مرده است؟!» چه غفلت بزرگی که می پنداریم خدا ترا برای مردگان ما نازل کرده است….
قرآن ! من شرمنده توام اگر تو را از یک نسخه عملی به یک افسانه موزه نشین مبدل کرده ام.یکی ذوق می کند که ترا بر روی دانه برنج نوشته ، یکی ذوق می کند که ترا فرش کرده ، یکی ذوق میکند که ترا با طلا نوشته و...عمـــــارهـا313

قرآن ! من شرمنده ام… 
avatar حذف خطوط ایجاد شده (AutoFormatted Lines) در Word  
قبلاً برخی از قابلیتهای موجود در نرم افزار Word را در مطلبی تحت عنوان «اگر از کاربران پر استفاده از Word هستید؛ این نکات مفید واقع میگردد (قسمت دوّم)» ذکر کردیم که یکی از این موارد مربوط به درج خطوط(با اشکال مختلف) با استفاده از کلیدهای کیبرد بود: برای درج خطوطی زیبا در متن، می توانید از کلیدها زیر استفاده نمائید؛ بدین صورت که اگر در ابتدای سطری که قصد ایجاد خط در آن را دارید کلیک نموده و : سه مرتبه خط تیره (بدین شکل --- ) تایپ و بلافاصله(یعنی بدون زد

avatar حذف خطوط ایجاد شده (AutoFormatted Lines) در Word 
فکر اینکه تحریمشون باعث تسلیممون شده خفت باره...  
این روزا بحث توافق نامه ژنو یا ترکمنچای هسته ای!!خیلی داغه...
 
خیلی وقته دلم میخواد یه چیزی بنویسم تا آروم شم ولی نمیدونم چجوری...
 
بهتره اول یه چیزایی که فراموش شده رو یادآوری کنم..



نکنه یادمون رفته اینا برا چی بود...؟!
 
این همه پایداری و مقاومت برا چی بود..این همه شهیییییییید!
 
برا عزت ..استقلال ...آزادی... خدا... ایران...
 
برای اینکه من و شما امروز آرامش داشته باشیم و دستمونو جلو بیگانه دراز نکنیم...
 
برای اینکه رو پای خودمون وایسیم..
 
اینا کمه!

فکر اینکه تحریمشون باعث تسلیممون شده خفت باره... 
قرآن ! من شرمنده ام…  
قرآن ! من شرمنده توام ،اگر از تو آواز مرگی ساخته ام که هر وقت در کوچه مان آوازت بلند می شود همه از هم می پرسند:« چه کس مرده است؟!» چه غفلت بزرگی که می پنداریم خدا ترا برای مردگان ما نازل کرده است….عمـــــارهـا313

قرآن ! من شرمنده ام… 
آهنگ های پیشواز البوم ساحل چمخاله اثری از سعید مدرس  
 3317612
عیبی نداره
سعید مدرس

 3317610
بهونه بارون
سعید مدرس

 3317609
برو
سعید مدرس

 3317606
عاشق که باشی
سعید مدرس

 3317608
تبانی
سعید مدرس

 3317605
ساحل چمخاله
سعید مدرس

 3317611
زندگی زیباست
سعید مدرس

 3317607
بارون یکریز
سعید مدرس

آهنگ پیشواز

آهنگ های پیشواز البوم ساحل چمخاله اثری از سعید مدرس 
پرهیزگارشوید...  
    بخشی از وصیتنامه شهید    برادران پاسدارم! امیدوارم با بزرگواری خودتان این بنده ذلیل خدا را عفو کنید.  سفارشی چند از مولایمان علی (ع) برای شما دارم. در همه حال پرهیزگار باشید  و خدا را ناظر و حاضر بر اعمال خود بدانید.  یاور ستمدیدگان و مستمندان جامعه و یاور تمامی‌ مستضعفان باشید،  مبادا یتیمان و فرزندان شهدا را فراموش کنید. سلسله مراتب و اطاعت  از مسئولین را با توجه به اصل ولایت رعایت کنید.   در هر زمان و هر مکان، با دست و زبان و عمل،

پرهیزگارشوید... 
تبدیل مستقیم فایل word به powerpoint  
فرض کنید یک فایل Word در اختیار دارید و قصد دارید از این فایل Word، یک فایل PowerPoint تهیه کنید. برای این کار چه خواهید کرد؟ بایستی بدانید یکی از قابلیت‌هایی که از نسخه ۲۰۰۷ به بالای مجموعه‌ی آفیس وجود دارد، امکان تبدیل مستقیم فایل‌های Word به PowerPoint است. در این ترفند به نحوه انجام این کار می‌پردازیم…

تبدیل مستقیم فایل word به powerpoint 
تایپ آسان معادلات شیمیایی در Word با نرم افزار Fx chem v2.104.2  
تایپ آسان معادلات شیمیایی در Word با نرم افزار Fx chem v2.104.2
نرم افزار FxChem ابزار قدرتمندی است که می تواند بسیاری از مشکلات شما را در تایپ فرمول های شیمیایی در Word رفع کند. برای مثال هنگامی که در FxChem می نویسید h2so4 در Word به شکل نماد نوشتاری آن در شیمی تبدیل می شود . پس از نصب این نرم افزار در Word 2003 یک نوار ابزار جدید شامل دو آیکن اضافه می شود. در word 2007 این آیکن ها به ریبون Add-Ins اضافه می شوند.
ادامه مطلب

تایپ آسان معادلات شیمیایی در Word با نرم افزار Fx chem v2.104.2 
تصویری از قیامت بر مبنای قرآن  
در بسیاری از آیات قرآن, تصویری روشن از قیامت ترسیم شده است. برای مثال در سوره تکویر که در پایین آورده شده است. لازم به ذکر است که تصاویر زیر تماما نمادین بوده و به هیچ وجه نشاندهنده عظمت این واقعه نیستند
سوره التکویربه نام خداوند رحمتگر مهربان


و آنگاه که کوهها بهرفتار آیند

و آنگه که ستارگان همی‏تیره شوند

آنگاه که خورشید به هم درپیچد






وقتى شتران ماده وانهاده شوند
و آنگه که وحوش را همى ‏گرد آرند
دریاها آنگه که ج

تصویری از قیامت بر مبنای قرآن 
پلام را باید دید  
بهشت زمینی خدا (@polam.ir)
kami.

پلام را باید دید 
نحوه مشاهده تمامی میانبرهای صفحه کلید برنامه Word  
میانبرهای صفحه کلید آسان ترین و در عین حال سریع ترین روش برای کارکردن با کامپیوتر هستند و برنامه آفیس Word شرکت مایکروسافت نیز از این قاعده مستثنی نیست و تعداد زیادی از این میانبرها را شامل می شود در حقیقت 250 میانبر صفحه کلید در این برنامه وجود دارد . برای ایجاد لیستی از این میانبرها و مشاهده آن ها با ما همراه باشید . برای مشاهده تمامی میانبرهای صفحه کلید موجود در برنامه Word ما از قسمت macro که در این برنامه وجود دارد استفاده می کنیم . گزینه macro از ن

نحوه مشاهده تمامی میانبرهای صفحه کلید برنامه Word 
دانلود رایگان مترجم صدای آنلاین با پشتیبانی از زبان پارسی - اندروید  
مترجم آنلاین با پشتیبانی از 80 زبان از جمله زبان شیرین پارسی تقدیم شما دوستان عزیز

این برنامه فوق العاده کاربردی هست و با حداقل سرعت اینترنت (2G) هم کار میکنه. کلمات و جمله ها را سریع ترجمه و بدون نیاز به مصرف نت اضافی به زبان مقصد (ترجمه شده) پخش میکنه اونم با صدایی شیوا قابلیت ترجمه صدا هم داره. یعنی حتما لازم نیست کلمات را بنویسیدنکته خیلی جالب اون اینه که کلمات را بخوبی تشخیص میده

این نرم افزار رو مدیون alieffe یکی از کاربرای سایت یوسی ایران ق

دانلود رایگان مترجم صدای آنلاین با پشتیبانی از زبان پارسی - اندروید 
تو برای من عزیزترینی  
داستانی مناسب برای گروه سنی 7 تا 77 سال
انتشارات مهرسا:
جمع‌آوری
جعبه و توپ در شهر مد شده بود! جعبه‌های رنگارنگ، و توپ‌های فانتزی. همه‌ی
اهالی شهر ومی‌کی‌ها مشغول جمع کردن جعبه و توپ بودند؛ همه به جز پانچلو.
پانچلو هم برای این‌که از دیگران عقب نیفتد، سعی کرد هر کاری لازم بود انجام دهد تا مثل آن‌ها شود.
او
هیچ‌گاه تصور نمی‌کرد مجبور شود این قدر تلاش کند و از چیزهایی که برایش
مهم بودند صرف نظر کند تا صاحب جعبه‌ها و توپ‌های بیشتری شود.
تا

تو برای من عزیزترینی 
آموزش فعال کردن Word Warp در نرم افزار netbeans  
در این پست می خواهم آموزش فعال کردن شکستن خطوط طولانی یا همون word wraping در نرم افزار NetBeans رو آموزش بدهم.
با فعال کردن این قابلیت در نرم افزار NetBeans تمامی خطوط طولانی که کدنویسی کردید شکسته شده و به سر بعد می روند. (بدلیل آشنایی برنامه نویسان با مقوله Word Warping از توضیح اضافی صرف نظر می کنم!).
آموزش فعال کردن Word Warp در نرم افزار netbeans
ابتدا نرم افزار NetBeans IDE رو باز کنید و مسیر زیر رو دنبال کنید :
Tools > Options > Editor
در پنجره باز شده مشابه تصویر زیر تنظیمات رو

آموزش فعال کردن Word Warp در نرم افزار netbeans 
آز بیوانفورماتیک  
بسم الله
سلام
http://www.tbi.univie.ac.at/RNA/
> g
CACUCAUAUAAUCGCGUGGAUAUGGCACGCAAGUUUCUACCGGGCACCGUAAAUGUCCGACUAUGGGUGAGCAAUGGAACCGCACGUGUA
CGGUUUUUUGUGAUAUCAGCAUUGCUUGCUCUUUAUUUGAGCGGGCAAUGCUUUUUUU
Maximum expected accuracy structural neighbors
of an RNA secondary structure

>Homo_sapiens_tRNA-Ala-AGC-5-1 (tRNAscan-SE ID: chr6.trna66) chr6:28678366-28678437 (+) Ala (AGC) 72 bp Sc: 77.3
GGGGGTGTAGCTCAGTGGTAGAGCGCGTGCTTAGCATGCACGAGGcCCTGGGTTCAATCC
CCAGCACCTCCA

آز بیوانفورماتیک 
معرفی و دانلود برترین مجموعه کتاب های گرامر English Grammar In use  
​ در این پست قصد دارم یک سری کتاب برای یادگیری گرامر در تمامی سطوح زبان برای شما دوستان عزیز معرفی کنم ،خب میریم سره اصل مطلب :
مجموعه کتاب های English Grammar In Use مجموعه جامع و کامل می باشد که توسط برترین اساتید دانشگاه کمبریج (Cambridge) علل خصوص آقای ریموند مرفی (Raymond Murphy) کاملا با دقت تهیه و تدوین شده و شامل سه جلد می باشد که بنا به نیاز خودتان می توانید کتاب مورد نظر را انتخاب نموده و مطالعه کنید .
(سطح پایه و مبتدی)Essential grammar in use که برای افرادی

معرفی و دانلود برترین مجموعه کتاب های گرامر English Grammar In use 
معرفی و دانلود برترین مجموعه کتاب های گرامر English Grammar In use  
​ در این پست قصد دارم یک سری کتاب برای یادگیری گرامر در تمامی سطوح زبان برای شما دوستان عزیز معرفی کنم ،خب میریم سره اصل مطلب :
مجموعه کتاب های English Grammar In Use مجموعه جامع و کامل می باشد که توسط برترین اساتید دانشگاه کمبریج (Cambridge) علل خصوص آقای ریموند مرفی (Raymond Murphy) کاملا با دقت تهیه و تدوین شده و شامل سه جلد می باشد که بنا به نیاز خودتان می توانید کتاب مورد نظر را انتخاب نموده و مطالعه کنید .
(سطح پایه و مبتدی)Essential grammar in use که برای افرادی

معرفی و دانلود برترین مجموعه کتاب های گرامر English Grammar In use 
دعای سلامتی آقا صاحب الزمان  
اِلهى عَظُمَ الْبَلاءُ وَ بَرِحَ الْخَفآءُ وَ انْکَشَفَ الْغِطآءُبلا و مصائب ما بزرگ شده و بیچارگی ما بسی روشن و پرده از روی کار برداشته شدوَ انْقَطَعَ الرَّجآءُ وَ ضاقَتِ الاَْرْضُ وَ مُنِعَتِ السَّمآءُو امیدم نا امید شد و زمین(با همه ی پهناوری اش)بر ما تنگ آمد و رحمتش از ما منع گردید.وَ اَنْتَ الْمُسْتَعانُ وَ اِلَیْکَ الْمُشْتَکى وَ عَلَیْکَ الْمُعَوَّلُتنها توئی یاور و معین ما و مرجع شکایت ما و یگانه اعتماد ما،فِى الشِّدَّةِ وَ الر

دعای سلامتی آقا صاحب الزمان 
نه دی روز دشمن شکنی در ایران  
 مردم ایران در 9 دی بار دیگر ثابت کردند، قدرت درهم شکنی تمام توطئه های دشمنان اسلام و انقلاب داخلی و خارجی را با اسلحه  اتحاد و یگانگی و یکدلی و حمایت و فرمانبری از ولایت فقیه  حتی در آخرین لحظات پیروزی موقتی فتنه گران را دارند.
مردم ایران ثابت کردند، دارای بصیرت و توان دشمن شناسی و دشمن ستیزی و مقابله فرهنگی با فتنه گران بوده، و هرگز دین و کشور خود را به بیگانگان نمی فروشند. 


9 دی مردم ایران ثابت کردند، تا پای جان،  بر عهد و پیمان خود در حفظ م

نه دی روز دشمن شکنی در ایران 
برای اولین بار  
روزی که برای اولین بارتو را خواهم بوسیدیادت باشدکار ناتمامی نداشته باشی
یادت باشدحرف‌های آخرت رابه خودتو همهگفته باشی
فکر برگشتنبه روزهای قبل از بوسیدنم رااز سرت بیرون کن
تودر جاده‌ای بی‌بازگشت قدم می‌گذاریکه شباهتی به خیابان‌های شهر ندارد
با تردیدبی‌تردیدکم می‌آوری..
دکتر افشین یداللهیشاه کلوب...!

برای اولین بار 
قیمت بلیط سینماهای مدرن 10 هزار تومان شد/ قیمت بلیط در سینماهای ممتاز، درجه یک و دو ثابت می ماند  
محمدرضا فرجی مدیرکل امور سینماها سازمان سینمایی گفت: پیشنهاد شورای صنفی نمایش مورد بررسی قرار گرفت و تصمیم گرفته شد تا به غیر از سینماهای مدرن در سراسر کشور دیگر سینماها هیچ افزایش قیمتی نداشته باشند. 
وی در ادامه درباره افزایش قیمت توضیح داد: سینماهای مدرن تنها در روزهای پایانی هفته (پنج شنبه و جمعه) با قیمت بلیت 10 هزار تومان به مخاطبان سرویس خواهند داد و در بقیه روزهای ایام هفته قیمت بلیت سینماهای مدرن 8 هزار تومان خواهد بود. 
مدیرکل

قیمت بلیط سینماهای مدرن 10 هزار تومان شد/ قیمت بلیط در سینماهای ممتاز، درجه یک و دو ثابت می ماند 
- چگونگی حل مشکل تایپ فارسی اعداد در MS Word 2007 و نسخه های جدیدتر :  
 
در نسخه ۲۰۰۷ و بالاتر مانند ورد ۲۰۱۰ به خاطر تغییرات ظاهری و منوها شما باید راهی دیگر را برای تایپ فارسی اعداد در پیش بگیرید. برای این مسئله در ابتدا شما برروی File کلیک می کنید (در نسخه ۲۰۰۷ آرم MS) سپس بر روی Word Options کنید.
بعد از انتخاب گزینه Word Options ، پنجره Word Options باز می شود، در این پنجره قسمت Advanced را انتخاب می کنید و سپس قسمت Show Document Content را پیدا می کنید. در این قسمت شما به دنبال عبارت Numeral بگردید، پس از پیدا کردن این عبارت مقدار آن را به Contex ت

- چگونگی حل مشکل تایپ فارسی اعداد در MS Word 2007 و نسخه های جدیدتر : 
برررررررجام  
 
زنگ خطری که برای روحانی به صدا درآمد!

 
 

یادداشت وارده
 
سخنان ولی‌الله سیف رئیس بانک مرکزی ایران در مصاحبه‌ای با بلومبرگ که توافق هسته‌ای ایران و گروه 1+5 را بدون  «تقریباً هیچ» دستاورد اقتصادی توصیف کرد، 
زنگ خطری است که برای دولتمردان و حامیان برجام به صدا درآمده است.
 
هرچند این اظهارات در فضایی خارج از رسانه های داخلی برملا شده، اما با انتشار و واکنش های گسترده ای در میان اقشار مختلف مردم ایران مواجه گشت.
 
محرم ندانستن مردم ایران

برررررررجام 
فروش کلن لول 6  
فروش کلن لول 6
 
 
 



نام کلن کلش اف کلنز : پادشاه ایران

 

عکس اول 

 

قیمت کلن : 210/000 تومان

 

شماره تماس : 09104522566






 



 



 

 



نام کلن کلش اف کلنز : پادشاه ایران

 

عکس دوم

 

قیمت کلن : 210/000 تومان

 

شماره تماس : 09104522566





 



 


 


نام کلن کلش اف کلنز : پا

فروش کلن لول 6 
  

فروشگاه

لینک عضویت در کانال تلگرام

عضویت در گروه تلگرام جوک کلیپ عکس


کانال تلگرام



آخرین جستجو ها

جدیدترین مطالب

جستجو ها